Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YL14FM1
Length(NT) : 623
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_04399
Accession: ref|XP_001244958.1| Score: 468 E_value: 3e-45
KEGG Definition: cytochrome P450 CYP4/CYP19/CYP26 subfamilies
Accession: aor:AO090026000094 Score: 384 E_value: 7e-36
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism, Lipid transport and metabolism].
Kog Number: KOG0157 Score: 165 E_value: 1e-12
PFAM Definition: No Hit Found
Swissprot: Q9Y757|CP52L_DEBHA

Sequence:
>SY0AAD6YL14FM1
TTGGCATCAATACAGCAATTCGAAATGGCAACCTCTCTTCTTAACCAGCC
CTCCATCATCCTAGTTCTCTCACTATTCGGACTCTACCTCTTCGTCTCTC
TCACCCAAAGCATCTTCATCGCCTACAGACGCCATCTCTTTAAGCAAGCA
AGAGGTTGCAAACCCGCTCCTAAATATCCCCAACGCGACCCAATACTTGG
TTCAGACCTCTTCATCAAGAATACCAAATATGCAAAGAATGGTGGATTCC
TTGAGCTGGTCAAGGGACGCTACGCTACAGTCGGGGCCACTACCTTCACT
GCCCAACTGCCCGGCCAGCAATTCATCCAGACCGTCGAACCAGAGAACAT
CAAAGCCATGCTAGCTACACAATTCAAAGATTTTGAGCTGCCCGCTATCA
GGAAAGGCGCTTTTGCACCGATCTTCGGCCATGGGATTTTCACTACAGAT
GGGTCAGAGTGGGAGACCTCGAGATCACTCCTTCGACCGAACTTCAACCG
CGCGCAGGTAGCGGATCTGGACATGTTGGAAAAGCATGTATCTAAGGTCA
TCGCTAGGATCCCTCGGGACGGTTCAACAGTCGATTTGCAGACTCTCTTC
TTCATGCTCACCTTGGACTCCGC

Sequences in the Contig:

SY0AAD6YL14FM1