Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YL12FM1
Length(NT) : 660
Best Gene Model Blast : Link to GSTUMT00007587001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE63146.1| Score: 176 E_value: 2e-11
KEGG Definition: ankyrin repeat
Accession: aor:AO090113000090 Score: 176 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD6YL12FM1
TTGGGATAAAATGGGCAACTTTTTCTCAAGCAATTCTTCTGAGGTCCAAC
GCCCAACGCAAAGCAATATTGCCGGTGACCTTAGTGGGAATAGCGGTACT
GGTAATCAAATCAACTGTGGTAACACTACGAACATTTACCAAGGGGCAAC
GAACTCGTCCGGGAATCAGACCGAAATTTTGCAATGCTTATACAAGTCTG
CATACGAGTCGCACCGAAGTCGGGTTCGTGAGCCAGCAGAGGGAAAATGC
ACCTGGGTTACGGAACATCCAAAGTACATGGAGTGGGTAGGGAAAAAGGC
GGCGGCTCTCCTTTGGCTATCGGCGGACCCGGGTTGCGGAAAATCTGTCA
TGGCTTGGGCAGGGTATGGTAGTCGATCGATTATTGGAGGAGGGAAATAT
CAATGCTCGATCAAGTCGATATGGCACTGCGCTAAATATATCAGCATTCA
GACAGGACGAGAGTATAACCAGGAATCTATTACGGAAGAACGTCAAAGCC
TATTTCGGCGGAAGGGAGTATAATATCCACCAGACGAAGATACTTAGAGC
GAGGATGCTATAGCTTGAGGAAGAAGCATATGAAGCATATGAAGCATTTG
CAGAATTTGAATATGAAGCATATTTTGCAATTAAGTTTGTATGCAAAGCT
CTCTCCCTTC

Sequences in the Contig:

SY0AAD6YL12FM1