Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YK01FM1
Length(NT) : 606
Best Gene Model Blast : Link to GSTUMT00006670001 E-value : 8e-12
Numbers of ESTs : 1

Blast Results:

Nr Definition: kinesin heavy chain subunit
Accession: ref|XP_001268454.1| Score: 594 E_value: 6e-60
KEGG Definition: KINESIN HEAVY CHAIN
Accession: ncr:NCU09730.1 Score: 593 E_value: 4e-60
KOG Definition:
Classification: [Cytoskeleton].
Kog Number: KOG0240 Score: 415 E_value: 1e-41
PFAM Definition: Kinesin, Kinesin motor domain..
Pfam Number: pfam00225 Score: 352 E_value: 2e-34
Swissprot: P48467|KINH_NEUCR

Sequence:
>SY0AAD6YK01FM1
TTGGCAACAAGTCTCTTTCCGCTCTCGGAATGGTAATCAATGCCTTGACA
GATGGAAAATCTACCCATGTGCCTTACCGAGATTCAAAACTCACTCGTAT
ACTCCAAGAATCTTTGGGAGGTAATTCTCGGACAACCTTAATCATCAATT
GTTCCCCTTCATCATACAACGACGATGAGACACTCTCGACTCTCCGGTTT
GGTATGCGCGCGAAGTCTATCAAAAACAAGGCAAAAATCAACGCGGAATT
ATCGCCGGCCGAACTCAAGTCCTTGCTCATCAAGGCTCAAAACCAAAACC
TTACATTTGCCGAATATATTGCTTCTTTGGAAGGGGAGGTTACAATCTGG
CGTAGTGGTGATCTGGTTCCGAAGGAGAAGTGGGTGCCCCCAATCAAGAT
TGAGATACCAAAGGTAGATGCCAGAACCCGACGGGCCGATACACCGTCCA
AGCTAGCAGCCGCCGAGGCTGTGCAGGGCCCGTCTCGCCCGGAAAGCCGT
GTTGAAGTGAGATCATCAACACCAGTTATTCTAGAAAAGGATGAGAAGGA
TGAATTTCTCAGGAGAGAGAATGAATTACAAGATCAACTGGCTGACAGGG
AATCTG

Sequences in the Contig:

SY0AAD6YK01FM1