Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YJ22FM1
Length(NT) : 521
Best Gene Model Blast : Link to GSTUMT00012251001 E-value : 1e-134
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_01348
Accession: ref|XP_001791990.1| Score: 138 E_value: 3e-07
KEGG Definition: hypothetical protein
Accession: fgr:FG05213.1 Score: 130 E_value: 1e-06
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q0V3R6|SEC16_PHANO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane

Sequence:
>SY0AAD6YJ22FM1
TTGGGGTTCTCAGCCTCCATCTGCTAGTGGATATGAGCCTCCATCTACGG
GGTTTACCCCTTACGAACCGGGTAATAGCGACGGTGAAAATGAGGACGAC
AAACCTAAGCCGAAAAAGTCATTTATGGATGATGATGACGACGAGTTTAC
GAAAAAGGCTGCTGAGCAGGCAAGGAAATTGCAGGAAGAGGAAACCAAGA
AGGCTGAAGAGGAAAAGAATGCTGCTCAAGGTATATTCCACTAATAACCC
CGATACATTTGGGCACAGGCTCTAACTTTCTAGATGAAGGCAAGAAAGGT
TGGTTTGGCGGTTGGTTCGGAAAGAGGGATCCTAACCAACAAGGACCTAT
CAAAGCGAAACTCGGAGAAGAGAGCTCCTTCGTCTATGATCCAGATCTTA
AGCGTTGGGTGAATAAGAAGGCTGGTGATACTGCGACAGCTGCCCCGAAG
CCGGCGCCACCACCGAAGCGGGCCTCAACACCTGCCTCTCAACCATCCTC
CACCCCATCGACACCCGGATT

Sequences in the Contig:

SY0AAD6YJ22FM1