Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YI23FM1
Length(NT) : 475
Best Gene Model Blast : Link to GSTUMT00010982001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_09370
Accession: ref|XP_001589648.1| Score: 419 E_value: 6e-40
KEGG Definition: hypothetical protein
Accession: ncr:NCU06352.1 Score: 390 E_value: 7e-37
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG2262 Score: 315 E_value: 3e-30
PFAM Definition: OPT, OPT oligopeptide transporter protein. The OPT family of oligopeptide transporters is distinct from the ABC pfam00005 and PTR pfam00854 transporter families. OPT transporters were first recognised in fungi (Candida albicans and Schizosaccharomyces pombe), but this alignment also includes orthologues from Arabidopsis thaliana. OPT transporters are thought to have 12-14 transmembrane domains and contain the following motif: SPYxEVRxxVxxxDDP..
Pfam Number: pfam03169 Score: 205 E_value: 2e-17
Swissprot: P40900|ISP4_SCHPO
Gene Ontology:
GO:0005783 = Cellular component: endoplasmic reticulum
GO:0031142 = Biological process: induction of conjugation upon nitrogen starvation

Sequence:
>SY0AAD6YI23FM1
TTGGGATACGGGTAAATGGGTGATGGACGGGAGTGCAGATACGAACGGTG
AACATTGTTATGGTATTCTCGGTGACTCTGATGAGGAGGAGATTGGCGAT
GATCCTATTGATAACTCACCTTATCCTGAGGTACGAGCTTCGGTATCGGC
GAAAGATGATCCAGACATTTTGATAAATACCCCTAGAATGTGGGCATTGG
CCATGTTCTTTTCCTTAGTTGGCTCTGCGACAAATCTGTTCTTTTCTCTT
AGATATCCCTCCGTGTCAATTACTCCGGTGATTGCTCTTCTTCTAGCGCA
CCCATTAGGAAAGCTCTGGGACCACGTTTTTCCCGAGGCCGATGCGACTG
AAGTCGTCAAGTCGGAGGACGGATGGTGGGGGAGGTTAAAAACGCGGCTT
GGCCAAGGTCGGTGGAACCAAAAGGAGCATAGTTGTGTCTATATATCCAG
TAATGTATCGTTTGGTTTCGCTTTC

Sequences in the Contig:

SY0AAD6YI23FM1