Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YH20FM1
Length(NT) : 592
Best Gene Model Blast : Link to GSTUMT00006668001 E-value : 1e-165
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_04528
Accession: ref|XP_001223742.1| Score: 505 E_value: 5e-52
KEGG Definition: hypothetical protein
Accession: ang:An06g01120 Score: 500 E_value: 4e-52
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0419 Score: 471 E_value: 3e-48
PFAM Definition: UQ_con, Ubiquitin-conjugating enzyme. Proteins destined for proteasome-mediated degradation may be ubiquitinated. Ubiquitination follows conjugation of ubiquitin to a conserved cysteine residue of UBC homologues. TSG101 is one of several UBC homologues that lacks this active site cysteine..
Pfam Number: pfam00179 Score: 368 E_value: 3e-36
Swissprot: Q96UP5|UBC2_EMENI
Gene Ontology:
GO:0004842 = Molecular function: ubiquitin-protein ligase activity

Sequence:
>SY0AAD6YH20FM1
TTGGCTCAAGGAACATCTTCCTATTAGCATATTCAACATTTCGCTCTCGC
AATGTCTACCTCTGCTCGCCGTCGTCTCATGAGAGATTTCAAGGTATCTA
CCCCACTCATTACGGCCAGCCAAAGAAGCCCGAGTCATGACCCAACCGGT
ACTAACGAGTTTTCTCCCAGAGAATGCAAACAGACCCGCCGGCCGGTGTT
AGTGCGTCTCCCATTAGCGATAATGTCATGACCTGGAACGCCGTTATAAT
TGGTCCTGTTGATACTCCATTTGAGGATGGCACTTTCCGTCTCGTTATGC
ATTTCGAAGAGCAGTACCCGAACAAGCCTCCGTCTGTGAAATTCATCAGT
CAAATGTTCCACCCAAATGTCTACGCCACTGGTGAACTTTGTTTGGATAT
CTTGCAAAATAGATGGAGCCCAACCTATGATGTTGCCGCTATTCTGACCA
GTATTCAAAGGTCAGTTCCTCTCTCTATTTTCTAATTATCTCGTCGCCAT
CGCGTCTACTCGCATCCCAGTCATCCTGGATATTCAGCTTTCATGACCTG
GTCAGAGCCCGCTCTAACTCGCTCCCTTATCTAGTCTTCTGA

Sequences in the Contig:

SY0AAD6YH20FM1