Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YH09FM1
Length(NT) : 619
Best Gene Model Blast : Link to GSTUMT00010265001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial tricarboxylate transporter (Ctp)
Accession: ref|XP_755059.2| Score: 523 E_value: 1e-56
KEGG Definition: mitochondrial tricarboxylate transporter (Ctp), putative
Accession: afm:AFUA_3G05420 Score: 523 E_value: 6e-57
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG0756 Score: 277 E_value: 1e-25
PFAM Definition: Mito_carr, Mitochondrial carrier protein..
Pfam Number: pfam00153 Score: 108 E_value: 4e-06
Swissprot: O13844|YFG5_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>SY0AAD6YH09FM1
TTGGCAGCTCACCAGGTTCACGGGATGTCTAATACTGCCACAGACAGAGC
AAAAGAGAAGCCGAGCGTTACTCGTTCACTTATCGCAGGAGGTGACATTC
AACTTGATTCCCGCAGTGATTAAACGGGGCTAAAAAAAATTTGTCTAGCA
AGTGCGGGGGCGATCGAAATTGCGATTACCTATCCGGCGGATTTTGCGAA
AACGAGAACGCAGTTAAATCGTCGACTAGCCACTGCGGAGAAGCTTCCAT
GGCCCAAATTTGGAAAGGAATGGTATGCGGGGTGCACTACGGCCATAATT
GGCAACTCTATTAAGGCGGGCATTCGTTTTCTTGCATTCGACGCTTTCGT
TAGTCTCTTCGCGGACGAGAACGGAAAGATTAGTGGACCAAGAACTGTCC
TTGCAGGGCTTGGAGCTGGTACTACGGAGTCGTTGATCGCCGTCACACCG
TTCGAAAGTATCAAGACTCAATTAATCGACGATCGTAAATCCGGGAAACC
ACGGTAAGCTATATACCTGCTACTTGTAAGCGGAGGCGTTGATAGGAGAT
TATAGAATGCGGGGATTTATTCACGGCTCTAGAGTTATTTGGAGGGAGAA
GGGGTATCGTGGTTTCCTT

Sequences in the Contig:

SY0AAD6YH09FM1