Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YG20FM1
Length(NT) : 589
Best Gene Model Blast : Link to GSTUMT00000712001 E-value : 1e-142
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein MGL_1052
Accession: ref|XP_001731784.1| Score: 276 E_value: 4e-23
KEGG Definition: sui1; hypothetical protein
Accession: spo:SPBC23G7.05 Score: 275 E_value: 3e-23
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1770 Score: 301 E_value: 2e-28
PFAM Definition: SUI1, Translation initiation factor SUI1..
Pfam Number: pfam01253 Score: 209 E_value: 8e-18
Swissprot: P79060|SUI1_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus

Sequence:
>SY0AAD6YG20FM1
TTGGCCTTCGCATTCCCGTCCAACACACAAGCTATCACCGGCACAACACT
ACTACATTTCAAGTCCAAACCACTGCTCCGAAGCACCCAGAAACAGCTTT
CCCGCATACCCAACCCCCCTCGAAGTCTGTTTATGTCCATCGAAAATCTC
AAGGTTAATGAGCGCAACGGTCGCAAGACCTTGACGACTGTCCAGGGGTT
GTCTAAAGAATACAGTCCTAAAGCTCTTTTGAAAGCTTTCAAAAAGGAAT
ATGCTTGCAATGGCACTATTATCCAGGATAAGGACATGGGAGAGGTGATC
CAGCTTCAAGGCGATCATCGTACAAAGGTTATGGACTTCCTTACCGATAA
AGGAAGCGACAAGATGGGCAAGTACGCACTTGCCAAAGAGAATATCAAGA
TCCACGGGTTTTAAGCCCTGCGTCTCCAGCCTTCCTCAACACCGTTTACG
TTGGTATTTGAGGAATGCTTTGCGCTGGAAGACATGTGGGGTTTATTACA
GTGTGCATGCTTGAGATTTCGGGGGTTTGCAGTATACATACTTAATAAAA
CGTTACTCCAACGGATTCTGGCTGGAGGGGGTTTTGTTG

Sequences in the Contig:

SY0AAD6YG20FM1