Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD6YB06FM1
Length(NT) : 593
Best Gene Model Blast : Link to GSTUMT00005434001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62469.1| Score: 587 E_value: 4e-59
KEGG Definition: putative zinc transporter
Accession: aor:AO090701000813 Score: 587 E_value: 2e-59
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG2693 Score: 358 E_value: 4e-35
PFAM Definition: Zip, ZIP Zinc transporter. The ZIP family consists of zinc transport proteins and many putative metal transporters. The main contribution to this family is from the Arabidopsis thaliana ZIP protein family these proteins are responsible for zinc uptake in the plant. Also found within this family are C. elegans proteins of unknown function which are annotated as being similar to human growth arrest inducible gene product, although this protein in not found within this family..
Pfam Number: pfam02535 Score: 324 E_value: 4e-31
Swissprot: Q9XTQ7|KE4L_CAEEL
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD6YB06FM1
TTGGCAAGTCCCCCACCCCTACCGACGAGGTGAAGGATGGCAGAGCGAAG
AAACCCGAGCCAAGCAACTCCATTAAGCTCTCCTCATACCTCAACCTCAT
CGCTGACTTCTCCCACAACATCACCGACGGCCTTGCTATGTCCGCTGCCT
TCTACGCTGGTCCCATGGTCGGCGCGACCACTACCGTCGCCGTCTTCTTC
CACGAGATCCCGCATGAGGTCGGTGACTTCGCCCTCCTTGTCCAATCCGG
CTTTACAAAGTGGCAGGCCATGGGCGCACAGTTCTTCACTGCTGTCGGCG
CCTTCTTGGGGACGTTCATTGGCATCGCTATTCAGACATATTCTGCCTCT
GGCACTGCGGACGAGGCTGTCGGTGGTGAGGGGTCCGACGTGGGGATTTG
GGGCACTGGGTTGACGGCTGGTGATCTGGTGTTACCGTTCACGGCTGGTA
CCTTCTTATATGTGGGTTTCAGCGTGATTCCCGAGCTGCTGGAGACTGGG
AAGAACAAGGGAGAGGAGGTTAGAAAGTCGATTACTCAGGCGTAAGCTCC
CCTTGGTAAAAAAACGTGTTTGTGGAATGTGTCACTGATCGGT

Sequences in the Contig:

SY0AAD6YB06FM1