Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YP22FM1
Length(NT) : 468
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 373 E_value: 1e-34
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 344 E_value: 1e-31
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG4412 Score: 239 E_value: 2e-21
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAD63YP22FM1
TTGGGGGGACAACTTTGTACAAAAAAGTTGGAGGATACGAAAGGATAGTG
AAATTACTTCTTAAACGCGGGGATGTCATCCCTGATTCGCCGCGTACCGA
TGGCCGAACACCCTTATCGTTTGCTGCCTCAGGGGGGCATGAAGTTGTAG
TGAAGCTCCTTCTTCGACGCGGGGATGTCAACCCTAATTTGCCGGATACC
GATGGCCGAACACCCCTATCATTTGCTGCGTCCAAAGGATGCGAAAGGAT
AGTGAAATTACTTCTTAAACGCGGGGATGTCATCCCTGATTCACCGCGTA
CCGATGGCCGAACACCCTTATCGTTTGCTGCCTCAGGAGGACATGGAGCT
GTAGTGAAGCTGCTTCTAGAATGCGAGGGTGTCAACCCCGATTTACCCAA
TACCATTGGCCAAACACCCCTATCCTTTGCTACCTCGGAGGGACATGCAG
GTGTAGTCTCACTACTTC

Sequences in the Contig:

SY0AAD63YP22FM1