Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YN23FM1
Length(NT) : 504
Best Gene Model Blast : Link to GSTUMT00004128001 E-value : 2e-58
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 347 E_value: 2e-31
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 340 E_value: 5e-31
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 244 E_value: 5e-22
PFAM Definition: No Hit Found
Swissprot: Q9ULJ7|ANR50_HUMAN

Sequence:
>SY0AAD63YN23FM1
TTGGACACTGTGCATGTTTCTTCGGGATTGCTGAACTTGTGACCGCATTG
ATAAATGGTAAATGTTACGATATCAACCAACGAGATTGCACAGGTCGTAC
ACCTCTCTCATGGGCGGCGGGAATGGGACATGAAGGGACGGTAAAGGCAC
TGCTGGAGCGAGAGGATGCCGACCCTAATCTTCCGGATAAGCATAATCGA
ACGCCGCTCGGATGGGCTACTCTCGATGGACATGAAGGAACGGTTAATCT
ACTGTTGGGGCGGGGGGATGTCGACCCCAATCATGTAGATCATAATGGCC
GGACACCACTCGGGATTGCCGCTTTCTGGGGACATGAGGGAGTTGTGAGG
CTGCTTCTGGGGCGGGAAGACGTTGACCCCAATCCCACAGATATGTTTGG
TCGGACACCACTTGGTATTGCAGCTTTCGATGGACATGAAGGAGTGGTGA
GACTACTCCTGGGGCGGGAAGATATCGACCCTAACTGTCCAGATAACCGA
GACT

Sequences in the Contig:

SY0AAD63YN23FM1