Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YN03FM1
Length(NT) : 536
Best Gene Model Blast : Link to GSTUMT00008500001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4849 Score: 111 E_value: 2e-06
PFAM Definition: Atrophin-1, Atrophin-1 family. Atrophin-1 is the protein product of the dentatorubral-pallidoluysian atrophy (DRPLA) gene. DRPLA OMIM:125370 is a progressive neurodegenerative disorder. It is caused by the expansion of a CAG repeat in the DRPLA gene on chromosome 12p. This results in an extended polyglutamine region in atrophin-1, that is thought to confer toxicity to the protein, possibly through altering its interactions with other proteins. The expansion of a CAG repeat is also the underlying defect in six other neurodegenerative disorders, including Huntington's disease. One interaction of expanded polyglutamine repeats that is thought to be pathogenic is that with the short glutamine repeat in the transcriptional coactivator CREB binding protein, CBP. This interaction draws CBP away from its usual nuclear location to the expanded polyglutamine repeat protein aggregates that are characteristic of the polyglutamine neurodegenerative disorders. This interferes with CBP-mediated transcription and causes cytotoxicity..
Pfam Number: pfam03154 Score: 112 E_value: 1e-06

Sequence:
>SY0AAD63YN03FM1
TTGGGGGGCTCTCTGCTTACCATGGCCATAGTGGGTCGATGGGTCCTACC
ATTGCCGCTCTATTGGACAAGTATGGTGCTGATGGCTCACAGAATGCAAC
ACATCTTGATGGGCTCCACGATTTGGTGGCGGAATTCGGGGCAACTGTGA
AAACAGATCACCTGAGCAAACTCTTGTCGCTCTGCGGAGAGAATAAAACT
GCCCTATTCCAACTCGCCGAGATTCTCTCCCGCAGCACTCCCCCCAAACA
CTTTTCCCCAGCATCCTCTCCAACCCTTTCCTCCACATCCGCATCCGTAT
CTCCCTCTTCCCCTTCAAAAACAGCCTCCCACCAAATGACACCAACAGCC
GACGCCGACTGGACAGTAATCGGCACCAACCTCCACCGTCCGCCTATGTC
CGCACGCACCAACATCCCCAGATCCCCCACCTCGCCCTTAATCCACCCAT
CATCCTATGCAATCGCGCGCAATGAAGCCTTTGCCAAAGCCACCGCTGCA
CACCAAAGGTCCAAATCCGACCGCTTAATGTCCGGC

Sequences in the Contig:

SY0AAD63YN03FM1