Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YM24FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00006254001 E-value : 1e-112
Numbers of ESTs : 1

Blast Results:

Nr Definition: DNA-directed RNA polymerase III largest subunit, putative
Accession: ref|XP_001271388.1| Score: 897 E_value: 5e-95
KEGG Definition: DNA-directed RNA polymerase III largest subunit, putative [EC:2.7.7.6]; K03018 DNA-directed RNA polymerase III subunit C1
Accession: afm:AFUA_3G14370 Score: 892 E_value: 9e-95
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0261 Score: 1033 E_value: 1e-113
PFAM Definition: RNA_pol_Rpb1_2, RNA polymerase Rpb1, domain 2. RNA polymerases catalyse the DNA dependent polymerisation of RNA. Prokaryotes contain a single RNA polymerase compared to three in eukaryotes (not including mitochondrial. and chloroplast polymerases). This domain, domain 2, contains the active site. The invariant motif -NADFDGD- binds the active site magnesium ion..
Pfam Number: pfam00623 Score: 678 E_value: 3e-72
Swissprot: P04051|RPC1_YEAST
Gene Ontology:
GO:0005666 = Cellular component: DNA-directed RNA polymerase III complex
GO:0003899 = Molecular function: DNA-directed RNA polymerase activity

Sequence:
>SY0AAD63YM24FM1
TTGGGGTTCTGCCAAAGATTGAAGGGCAAACAAGGCCGATTCCGCGGTAA
TCTTTCAGGAAAGCGTGTAGACTTTTCTGGGAGAACTGTTATTTCACCGG
ATCCAAACTTGAGTATCGACCAAGTCGCTGTGCCGACATTGGTGGCCAAG
AACTTGACGTATCCGGAGAGGGTTTCCCGATACAATATTCACAAGCTACA
GCAACTAGTGCAGAATGGGCCAGATACGTGGCCGGGCGCTAATTATATCA
TCAAGAATGGTAGCGACTTCAAGCTGTGGCTAAAATTCGGAGACAGACGG
CGTGCTGCAGATGTATTAGTTGAAGGTGATATTGTCGAGAGGCATCTAGA
GGATGGAGATGTTGTATTATTCAATCGGCAGCCTTCCCTACATAAATTGA
GTATTCTCAGTCATTACGCCAAAATTCGACCATGGAGGACCTTCCGACTC
AACGAATGTGTTTGTAATCCGTACAATGCGGATTTCGACGGAGACGAAAT
GAATCTCCACGTGCCCCAGACCGAAGAAGCGCGAACCGAAGCAATCGAAT
TAATGGGCGTCAAGAACAACCTTTGCACGCCTAGAAACGGCGAACCTATT
ATTGCAGCTATCC

Sequences in the Contig:

SY0AAD63YM24FM1