Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YL16FM1
Length(NT) : 554
Best Gene Model Blast : Link to GSTUMT00011675001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_01791
Accession: ref|XP_001597597.1| Score: 215 E_value: 4e-16
KEGG Definition: hypothetical protein
Accession: mgr:MGG_07326 Score: 200 E_value: 1e-14
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2133 Score: 123 E_value: 7e-08
PFAM Definition: Extensin_2, Extensin-like region..
Pfam Number: pfam04554 Score: 110 E_value: 2e-06

Sequence:
>SY0AAD63YL16FM1
TTGGAACCCCCCCACCACCGCTCAAGTCAACCAAAAATCTCAATTCTACC
GAAAAAAAATAATAATAATAAAATAAACCCACGACCGAAATGCCACTAAC
AATCCTCCGCCAATCCCCGGACCTCTCATCCTACACCCCTCTCTCAACCC
ACCAATCCTCCACCCCGGCCTCCTTCCAAACCCCAGTATTGCACTTCCAC
GCGCCCTCCGCCACCGTCCTGATCGCGCCAGAACACATCTCTCTCCTCCC
CATATTCCCAGATGTCCCCACCCCTTCCCCGACCACATCAGACCAGTCCC
GAATCCCCAATATCGAACTCCTGATAATCTCCCAAACCCTCACCCTCTAC
AACGCTCCCTCAAAGATCGGCATAAGCCTACCTTACTCATCCATCACCCT
GCATGCCATCCAGCGGACCCCACATGGTGCAGGAATTTACATGCAGATAT
CGCTCTCCCCTGGGAACGCTGCAGCGCACACGAATACGGACGAGTATGAT
CAGGATGAATTGCTGGAGATTACCATTCTGCCCGATACGGCCGGTGAAGG
GGAG

Sequences in the Contig:

SY0AAD63YL16FM1