Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YL15FM1
Length(NT) : 596
Best Gene Model Blast : Link to GSTUMT00002333001 E-value : 1e-123
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_10200
Accession: ref|XP_001228127.1| Score: 158 E_value: 2e-09
KEGG Definition: hypothetical protein
Accession: fgr:FG00333.1 Score: 151 E_value: 7e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD63YL15FM1
TTGGCTCCTCGATCGACATTTTAACACACTGTTGGAAGCGACCTGAGCGA
AAATCCGAACAGGAAAGAGTCCGCAACCCGTAAAATCGTGGGGAAGTTGA
TTGACTGCCTGGCTGACGATATCTGGAGAAACCAGCCACAAAGGGCTCAA
CCTCAACTCCGCACGGGCAACAGCGCAGGTTCAAAAAAAAAAAAAAAAGT
CCACGCCCGGCCCACCAGAGCCCAACAACGTCCGCTCCATCGGTTCAAAG
CCTTGAGTTGCAGTTTTTTATCGGCACGACATCACGCTACCGATCTACTT
TCTTTGAGCTCACGTCCACCGTCAGTATCAACTACTGTACTCGCCGGCCA
TCAGGATAGAGCAGAGCAAACAATATGCCACCAAGAGTCAACATCCCCCC
TTTAACAAGGGGTTGCCTGGTAGTATGCGTCTTCCTATCCGTCCTTACCG
GCGCTCTTCGCTACCGGGACCGGGTGGCTCGTCAAGAAGAATACCCCCCG
GATTCACCAACTGGCGGCGGCGGATCACAGATCTACACAGTCCCCTACTT
GACGGTTGTCCCGGCCCTGTCGATAGTGTTTCCGTGGACGTTTTTG

Sequences in the Contig:

SY0AAD63YL15FM1