Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YK20FM1
Length(NT) : 559
Best Gene Model Blast : Link to GSTUMT00009176001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_04535
Accession: ref|XP_001794950.1| Score: 446 E_value: 7e-43
KEGG Definition: hypothetical protein
Accession: ncr:NCU08373.1 Score: 437 E_value: 4e-42
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q7SGP2|PEX6_NEUCR

Sequence:
>SY0AAD63YK20FM1
TTGGAGTATTTGTTGATCCAGCGAGCACTCGCATGGTTCAAGCCGGGTCT
GAGAGACGGAAGATACCACCTACTATCAGTTCTACTTGGGAGTACTACTT
TGGACTGCATCCGCCGCCTCTACGATTGGCCGCCGTTCAAGGAGTTCCGC
CAGCGTTGATCGTGCCAGCACGTTATGTCAGTCAGACTCAGCGACGCCTG
AGAGAATTGGTTTCTGCGGCTACCTCTCAGAGAGCCGTTCAATTGGAGTT
GCAATCGATCGCTATCCTATTGACAAGCACTCAAAGGTCCATTGGCAAAC
GGACACTAGCAATGAGAGCCGCGGCTGATGTCGGAGCCCACGTTTTCCAC
ATAGACGCTTACGATATCACCTCCGACGGTGGTCCCGGGGACGTAAAGAC
AGAAGGCTTCTTGCGAGCTAGGGTTGATAGGGCACTCTCCTGCGGTAAAG
AAAGCTGTGTTCTACTACTCTCCCACATCGAAGCCCTTACATCGGCACGA
ATGGGGGAAGTATTAAAAGACATTGTGGGCCAAATGCGTATCATCATCGT
GACAACGGC

Sequences in the Contig:

SY0AAD63YK20FM1