Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YK14FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00003753001 E-value : 1e-130
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_06787
Accession: ref|XP_001797150.1| Score: 393 E_value: 4e-60
KEGG Definition: branched-chain amino acid aminotransferase, cytosolic [EC:2.6.1.42]; K00826 branched-chain amino acid aminotransferase
Accession: afm:AFUA_4G06160 Score: 366 E_value: 2e-58
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0975 Score: 277 E_value: 1e-25
PFAM Definition: Aminotran_4, Aminotransferase class IV. The D-amino acid transferases (D-AAT) are required by bacteria to catalyse the synthesis of D-glutamic acid and D-alanine, which are essential constituents of bacterial cell wall and are the building block for other D-amino acids. Despite the difference in the structure of the substrates, D-AATs and L-ATTs have strong similarity..
Pfam Number: pfam01063 Score: 197 E_value: 2e-16
Swissprot: P38891|BCA1_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004084 = Molecular function: branched-chain-amino-acid transaminase activity
GO:0009082 = Biological process: branched chain family amino acid biosynthetic process
GO:0009083 = Biological process: branched chain family amino acid catabolic process

Sequence:
>SY0AAD63YK14FM1
TTGGTCTCACTCCTCCGGGCGATTCGCACCCCACAGGCCCTGAGAGCCTA
TAGCACTCAAACCATCCCTGACATTGATGCTTCAAAATTGACCATTACCC
GCACCCAAACACCAAAGGCTCTGATGAAACCAGAGGACCTTATCTTTGGG
CGCAACTTCACCGGTACCCCCACTTTCCCTACTGCACATCGCCCAAGAAA
TCTTACAATAAAGAATGTAGACCACATGCTATCTATCGAATGGACCGCTC
GATCTGGCTGGGCCGCCCCTAAGATAACTCCATATCAAAACCTCTCCCTC
GATCCCGCAACCTGCGTTTTCCACTACGGTTTCGAATGCTTTGAAGGAAT
GAAGGCCTATCGCTCCACCGTGAACGGGAAGTCCAGCATCCGCATGTTCC
GCCCTCATAAAAACATGCAGCGCTTAAATAAATCCTCTGTTCATTCCGGA
TAAGCGGGGCTATTCCCTCTATCTCAGACCCACCATGATTGGAACCCAGA
GCACTTTGGGTGTTGGCAAACCCGGGAGTGCACTGCTATTTGTTATTGCT
TCCCCGGTAGGCCCGTATTATCCTACTGGATTCAAAGCAGTCAGTCT

Sequences in the Contig:

SY0AAD63YK14FM1