Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YK10FM1
Length(NT) : 432
Best Gene Model Blast : Link to GSTUMT00011704001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG07283.1
Accession: ref|XP_387459.1| Score: 558 E_value: 5e-56
KEGG Definition: hypothetical protein
Accession: fgr:FG07283.1 Score: 558 E_value: 2e-56
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1232 Score: 488 E_value: 2e-50
PFAM Definition: FAD-oxidase_C, FAD linked oxidases, C-terminal domain. This domain has a ferredoxin-like fold..
Pfam Number: pfam02913 Score: 315 E_value: 2e-30
Swissprot: P46681|DLD2_YEAST
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0003779 = Molecular function: actin binding
GO:0004458 = Molecular function: D-lactate dehydrogenase (cytochrome) activity
GO:0006089 = Biological process: lactate metabolic process

Sequence:
>SY0AAD63YK10FM1
TTGGGGGTCCTAGCCCAAGATGAGACACAGGCACGCAACCTGTGGTCGTG
GAGAGAAGGTATCCCGGAGGTCTGTGGTCACTGGGGTGGAGTATACAAGT
ACGACGTCTCAATCCCGCTAAAAGAGCTCTACTCGCTTGTGGAGGATGTC
AAGGCAAGACTCATTGAGCACGGGCTGCTAGGGGAAGACAAGCCTGTGGT
CGACGTTCTCGGATTCGGCCACATAGGAGACGGCAACCTCCACTTGAACG
TACCTGTGAGATCTTACGACAGGTGCGTCGAGGAAGCACTTGAGCCATTT
ATCTACGAGTGGATAGAGAAGAGGAGCGGTAGTATCAGTGCTGAGCATGG
GCTTGGTGTCGCTAAGAGGGAGTATGTACAGTATTCCAGAGGAGAGACCG
CGCTGGGTGTCATGAGGAGCTTGAAGAATCAT

Sequences in the Contig:

SY0AAD63YK10FM1