Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YJ05FM1
Length(NT) : 482
Best Gene Model Blast : Link to GSTUMT00011686001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001539141.1| Score: 177 E_value: 7e-12
KEGG Definition: permease of the major facilitator superfamily
Accession: aor:AO090005001154 Score: 172 E_value: 1e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD63YJ05FM1
TTGGGTCGCTGCTAGTGCCGCAAGCATCTCTCGAGCTTTGGGCCCGACTA
TTACCGGAATGATCTACACTCAAGGCCTCGACTGGGGGATGGTGGGGCTT
GCTTGGTGGGTCAATGCGGGTGTCTGTGTGCTCGGTGGCATTCAATGTCT
ATGGATGAAAGAGGAAGACTTCGACGGCAACAACAAAACCGGGGAGATTG
TTATAGACGAGGAAGTTTGCTGGAGGGTTGCAGCAGAAACGCAGGCTGCG
CATGCACATAATACGGGGCTGGTATCTGGAGAGGAGTTTATTAGCGAGTG
CACGATAGCACGTAAGACCGCCGGCGAGGAGGTTGCCAACAGCTTTGGGG
AAGAGGGGGATATGGGTGGAAGAAGCGAGTAGGGCCAAGAAGAGCGAAGC
GAACTCTTGTTGGTCAATTGATCCATTGTACATAGCCACTCCTTGCCCCC
CCATGGGGTCCAGAAATTATGATCCCAATGAG

Sequences in the Contig:

SY0AAD63YJ05FM1