Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YI22FM1
Length(NT) : 524
Best Gene Model Blast : Link to GSTUMT00010279001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_03740
Accession: ref|XP_001557476.1| Score: 322 E_value: 1e-28
KEGG Definition: hypothetical protein
Accession: fgr:FG03158.1 Score: 250 E_value: 2e-20
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD63YI22FM1
TTGGGACACAGACCTGTCCCCGCGCGTGGACAACGCTTTCCACGCGCTCG
CGCTCGACGAGCACCGTGGGCCCTTCACGCCCACGCTGTGGAAGAAGACT
GACGACACCCCGGTCAACCTCAAGCAGTGCTGGTTCCCTGGCGTCCACAC
AAATGTCGGCGGCGGATACGAGGACCAGGAGATCGCGGACATGACTCTCT
CCTGGATGATCCAGCAGCTCTTGCCGTTCCTGCAGTTCGACGATGACTAC
CTCAAGATTATCATCCATAACAGCGACGACCACTCCAGTGGCGAGTGGGC
CGCTGGCAAGATCTACGACTCCGCGACCGGGATCATGAGGATTGTCGGCG
GGAATACCAGGACTCCCGGGGGGTATGGGGACGGTACCGAGGAGACTATC
CATAAGAGTGTGAGGATTCGCACGAAGGTTGTTTCCGGCTGGTCTAGCAA
GGCTTTGAAGGGATGGACCTGGAATGAGAATGGGTATTGGGAGAAGGGCA
GTAAGAGAATGGCGGAGGATCAGT

Sequences in the Contig:

SY0AAD63YI22FM1