Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YH18FM1
Length(NT) : 496
Best Gene Model Blast : Link to GSTUMT00012063001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CHGG_04743
Accession: ref|XP_001223957.1| Score: 301 E_value: 3e-26
KEGG Definition: hypothetical protein
Accession: fgr:FG09829.1 Score: 284 E_value: 2e-24
KOG Definition: No Hit Found
PFAM Definition: NCA2, ATP synthase regulation protein NCA2. NCA2 has been shown to be required for the regulation of ATP synthase subunits Atp6p and Atp8p in Saccharomyces cerevisiae..
Pfam Number: pfam08637 Score: 363 E_value: 9e-36

Sequence:
>SY0AAD63YH18FM1
TTGGGTGGACGTCGAGGTAGCCATCAGTGGGATTGATCATCTTCTCAAGT
CACAGGAGTTGGTTTTTGGCATGGTGGGTCTTACTCCTAGTGCACTAGCC
TGCGTAGGAATATTCCAGTGGGCAAGGCATTCTATGGGCAAAGGCAGAGG
CCGTCGTAGCGGCCAGCGTGGCGGAGAGATGGTCAGAACTTTAAGAAACA
TCGACAGAATCCTTACCGGTAGCGCCGCTTACAGAACTGGTGAACGTGAT
GATGATAGAGGCGGAGTCCTCACTTACAAAGAGCACGGCCTGCTACTTTG
CGAGGTCCATGTCCTAAGGGAGTTCGCCAAGAAGACTCTTCCAATAGGCG
TTTGGGCCGAGTTCGTGGAGGATGTGGAGGAGCTGGTCGATGTGAGACGG
GGTGTGAAAAACCAATTCAGGGTCTTGGAGAGAATTAGATGGGCATATGC
AAAGTGGATCAGATAGTAAGGACATCCCGGCAGGGTGTAACGGTTA

Sequences in the Contig:

SY0AAD63YH18FM1