Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YH01FM1
Length(NT) : 424
Best Gene Model Blast : Link to GSTUMT00000896001 E-value : 1e-92
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein FG06640.1
Accession: ref|XP_386816.1| Score: 333 E_value: 6e-30
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG06640.1 Score: 333 E_value: 3e-30
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport, Cytoskeleton].
Kog Number: KOG0073 Score: 277 E_value: 5e-26
PFAM Definition: Arf, ADP-ribosylation factor family. Pfam combines a number of different Prosite families together.
Pfam Number: pfam00025 Score: 261 E_value: 4e-24
Swissprot: Q9D0J4|ARL2_MOUSE
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD63YH01FM1
TTGGATGTGATACGATAGGGCAAAGAAAACAAGCAAAGCCAGACCTCCTT
CTCGATTTCGCTCCCCCTTTCCCAATACCGTACTACACGATAAACGGGTT
TCTCACAATTCAGCTGAGCGCCACCAGCACGACGACCGCAGCAAACGTTA
AACCCTAGGAAGGGAAAAGAAAATAATACAAAAAACAAAAACAAAAAAAA
GCAAGATGCTCGCAATATTACGGAAATCACGACTGAAGGATCAGGAGATG
CGCGTGTTAATGCTGGGACTTGACAATGCCGGAAAAACCACCATCGTCAA
GCACGTCATGGGCGAGGATGTGAGGACTGTGAGTCCCACGTTGGGATTCA
TTATCAAGACAATCGATTACAAAGGTTTCAAGCTGAACATATGGGATGTG
GGCGGCCAAAAAACCCTCCGCAGT

Sequences in the Contig:

SY0AAD63YH01FM1