Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YF22FM1
Length(NT) : 597
Best Gene Model Blast : Link to GSTUMT00006412001 E-value : 1e-111
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_12576
Accession: ref|XP_001802797.1| Score: 212 E_value: 1e-15
KEGG Definition: hypothetical protein
Accession: ncr:NCU07673.1 Score: 201 E_value: 1e-14
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG2743 Score: 179 E_value: 2e-14
PFAM Definition: cobW, CobW/HypB/UreG, nucleotide-binding domain. This domain is found in HypB, a hydrogenase expression / formation protein, and UreG a urease accessory protein. Both these proteins contain a P-loop nucleotide binding motif. HypB has GTPase activity and is a guanine nucleotide binding protein. It is not known whether UreG binds GTP or some other nucleotide. Both enzymes are involved in nickel binding. HypB can store nickel and is required for nickel dependent hydrogenase expression. UreG is required for functional incorporation of the urease nickel metallocenter. GTP hydrolysis may required by these proteins for nickel incorporation into other nickel proteins. This family of domains also contains P47K, a Pseudomonas chlororaphis protein needed for nitrile hydratase expression, and the cobW gene product, which may be involved in cobalamin biosynthesis in Pseudomonas denitrificans..
Pfam Number: pfam02492 Score: 133 E_value: 5e-09
Swissprot: Q4V339|CBWD6_HUMAN

Sequence:
>SY0AAD63YF22FM1
TTGGAGAGTCTGCCCCATCGTCCGCATCACCAAGCATAGACGCTTCACTT
CCTACCGACCCGCCAGCCTCGACACAGCACCATCTCACTCCAACATATCA
CAGAAATGAGCTCCGATCACCTTGACCTTGACGATGAGGAGCCCCCAGCT
CTAGTTTCGACTGAAACTCTCCTCAGCCTCGAAGACCTTCAGCTATCAAA
GGCACCGATAACAATTGTCACGGGATACTTGGGAGCTGGGAAAACTACCC
TCTTAAACTATATCCTTACTGAGCAACATTCAAAGAAGATCGCAGTCATT
TTAAACGGTGGGTAGTTTCTCATTCACTGATTTAGTTACTCCACTGTGCT
GCCCTACCTTATTTAGTGTGTTTGCTAATATTACTTGTTTAGAATTTGGA
AACTGTGAGCTCATCCCCTAATGCCCGACAGAAACCCTTCCGTTGCGGGT
CAAGCTTGGAATATTTTGTTAATGATGAAGACAATTTGACTGGGCGGTTT
TGAATAGCAAGCGATATCGAAAAATCGTTAACCATCCAGAGAGATGGTCA
GCAAGTTGAAGAATGGCTGGAGCTAGCAAATGGCTGTAAGCACACCG

Sequences in the Contig:

SY0AAD63YF22FM1