Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YE23FM1
Length(NT) : 613
Best Gene Model Blast : Link to GSTUMT00004093001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_06977
Accession: ref|XP_001591531.1| Score: 237 E_value: 2e-18
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_1G05550 Score: 158 E_value: 1e-09
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD63YE23FM1
TTGGGACCGATATGATGATTCGAGAAAAAGCCAAATTTTTCGCGACCAGC
GTAGGGATATCGGACAGTCAGTTCAAGGCAAATGGCCAGGGTTGGTTGGA
GAAGTTCAAGCAGAAGAACAACCTTCACTCGAATGGGCGAGGAAGATCGG
AAAGCGATGTGACTGGTGTGGCTAGGATGGCGAGCGGAGGGTTGATGTCA
CCAAAGCCAGGCCACTCTAGAACGGATTCAACACCAGTATTAGGGTCGCC
TATGATGCAAGAATCCAAGAGCCAGGATAGCAGTCATAATGGTACAGATT
CGCCGGAATCATTTATGGAGTTTGGGGGGTTCAATAAACAACAAGTCTCG
GTTTCTAATTACGCAGGCCCAGCTTCTCCGACCTCCCCATTCTTCTCGCC
AGATCAGCGGGTCGACCCTCTGCAGGCACGGATGCCGCACCTGCAACAGC
GCCCAAGATCACAGACATTTCCCACCCTATCTGTTGACCCGACCTACATA
TCCCCACCACCATCGTCAGAGCCGTTGACCCCTAAGATGTTAAACCAGAC
TGTGGTACCCCCGCCGGCACTCGCATCCCCTGCCCCTGACGTGCCCAACC
CATTGGCATCGCC

Sequences in the Contig:

SY0AAD63YE23FM1