Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YE05FM1
Length(NT) : 565
Best Gene Model Blast : Link to GSTUMT00006971001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: catabolite repression protein creC
Accession: ref|XP_001215051.1| Score: 564 E_value: 2e-56
KEGG Definition: WD40 protein DMR-N9
Accession: aor:AO090003000149 Score: 563 E_value: 1e-56
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG2394 Score: 258 E_value: 1e-23
PFAM Definition: No Hit Found
Swissprot: Q9P4R5|CREC_EMENI
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0045013 = Biological process: negative regulation of transcription by carbon catabolites

Sequence:
>SY0AAD63YE05FM1
TTGGGATATGTTGTCACAGGTGGTCAGGATGACCTAGTATCCATATGGTC
GTTTCATGATCGGCGCATCGTAGCTCGCTGTGAAGGACACCATTCATGGG
TATCTAGTGTTGCCTTCGATCCTTGGCGTTGCGATGATCGTACCTATCGT
TTTGGGAGTGTTGGAAACGACTGTAGGTTGCTGTTATGGGATTTTAGTGT
TGGAATGCTTCACAAACCAAAAGCGGCGGCCACACAGAACCGTGGGAGCA
TGTCATCTCATAATTACCAGTCTCAAAGCGGAAGAATTCGCGTAGAGAGC
CTCTCGGGGAGGTTGCGGTCAAATTCTAACATCGCTTCCATCCATGACGA
GAGTTCAGACCAAGAAATCGCTGTTCATCCCGTAGAGGAACGTGCACGCA
CCGCAGTTTTACCACCGATCATGTCGAAAGTCATTGACGCGGAGCATCTT
ACCCAGCTAGTTTTCCGGGAAGACTCAATCGTTACAACATGCGTGGATGG
GCACTTGAAGACGTGGAATCGACCACATGTAGGGCAGACTCGGAATGGTA
GCGAGGTGACGCTTT

Sequences in the Contig:

SY0AAD63YE05FM1