Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YD17FM1
Length(NT) : 661
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: mitochondrial processing peptidase beta subunit, mitochondrial precursor
Accession: ref|XP_001593250.1| Score: 999 E_value: 1e-107
KEGG Definition: mitochondrial processing peptidase beta subunit, putative [EC:3.4.24.64]; K01412 mitochondrial processing peptidase
Accession: afm:AFUA_1G14200 Score: 886 E_value: 5e-94
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0960 Score: 746 E_value: 5e-80
PFAM Definition: Peptidase_M16, Insulinase (Peptidase family M16)..
Pfam Number: pfam00675 Score: 517 E_value: 2e-53
Swissprot: P11913|MPPB_NEUCR
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004240 = Molecular function: mitochondrial processing peptidase activity

Sequence:
>SY0AAD63YD17FM1
TTGGCACGACCAGCTCCATCACCCTCATTCACAGCTTCGATGGCGTCCCG
CCGGTTAGCCCTCAACCTTACCCAAGGACTTCGCAGTCGTGCGGCCCTCA
ACACAGTTTCCCCATTGAAGAGAGGCTTTGCGACTCCTGTTATTAAAAAT
GGCGTGAAGACGGAATCAACAACTCTCTCGAACGGTTTTACGATCGCTAC
GGAACATTCACCATGGGCACAGACATCGACGGTCGGCGTGTGGATTGATG
CTGGGTCTCGAGCAGAAACTGACAAGACCAATGGCACAGCACACTTCCTG
GAGCATCTTGCTTTCAAGGGTACCAGCAACCGGACACAACATCAATTGGA
GTTGGAAATTGAGAACATGGGTGGCCACTTGAACGCCTACACATCTCGTG
AGAACACCGTATACTATGCCAAAGCCTTCAATGCCGATGTTCCAGCCACC
GTCAACATCCTCGCCGATATCCTTCAAAACTCGAAGTTAGAGCCACAAGC
AATTGAGCGGGAGCGTGACGTTATCCTGAGAGAGTCGGAGGAGGTGGACA
AACAATTGGAGGAAGTTGTTTTCGATCACCTACACGCAACTGCTTTCCAA
GGACAACCTCTAGGCCGCACGATTCTAGGCCCTGCTGAGAACATCCAATC
CATCCAAAGAG

Sequences in the Contig:

SY0AAD63YD17FM1