Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD63YB17FM1
Length(NT) : 620
Best Gene Model Blast : Link to GSTUMT00004898001 E-value : 8e-92
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ser/Thr protein phosphatase family
Accession: ref|XP_001274190.1| Score: 305 E_value: 2e-26
KEGG Definition: hypothetical protein
Accession: ani:AN4713.2 Score: 274 E_value: 4e-23
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD63YB17FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCCGAGTCTGAGCGTGGAGA
GAAAATTGGCAAAATCTTTGTCCAAGAAGCAGGCTGAGTGGTTGGATGCT
TGCCCGCTTGTGGTTCGAGCTGAGAAGGTTCCTGGGCTTGGACAGTATTA
TATTGTGCACGCTGGGTTGGTGCACGGTATCGGGCTTAGGAGACAGGTAT
CTACTGTATTTCCTATTTGGATATTCTGAGGACTATGCTGATTAGGTCTG
AAGGACCCCGTGGCGATAATGACCATGAGAACCCTCAACCATCATCTCGT
CCCATCGCCAAAACAGAACGGAATGCACTGGGCGAAGTACTGGAACAAAA
TGGAGAGGAGAGAAACCCATGGTCATACCACCGTAGTGTTCGCCCTCCAT
TTATTCACCCGAATTATGCCGCCAGACGCTGACACGGTGAATAGCTACGG
CCACTACGCAGCCGAAGGGCTTGACATCCGCCGCTACACAAAAGGTCTCG
ACAGCGGTTGCATTCGCGGCAGGAGACTGTCCGCATACATCCTCAAAGCG
AATAAAGGGGGAAGAGTAGAAGAGGATATTGTGAGCGTTAAGTGCAGAGA
ATACCTCGACTAGAACTGTC

Sequences in the Contig:

SY0AAD63YB17FM1