Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YO21FM1
Length(NT) : 604
Best Gene Model Blast : Link to GSTUMT00008048001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_09061
Accession: ref|XP_001239440.1| Score: 224 E_value: 7e-31
KEGG Definition: acyl-CoA synthetase [EC:6.2.1.16]; K01907 acetoacetyl-CoA synthetase
Accession: aor:AO090001000376 Score: 234 E_value: 5e-30
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1175 Score: 134 E_value: 4e-09
PFAM Definition: No Hit Found
Swissprot: Q9N0E1|AACS_MACFA
Gene Ontology:
GO:0030729 = Molecular function: acetoacetate-CoA ligase activity

Sequence:
>SY0AAD62YO21FM1
TTGGGTTTGATCTCTGTTTTCTTCTTTGCCTCATCAACAATCATAATACG
CAATTCTTTCTCTCTTGACTATTTTTGTCAGTTCAGGGAGAAATGACTTC
AGAGAGGGATCAAAACAAGAATCGAGAGAGGGACAGTGAGAAGCTTTGGG
AGCATTCTTCCCCGGAGAGAACGACAATGTACCAATTCAAACGGCACATC
TCGGAAAAATACTCACGAGAGTTCTCCGGTGAGGAAGACAAGTTCAATTC
CTTATGGGCATGGTCGGTCGACGAGATTGAGAGCTTCTGGAGCGAAATTT
GGAATTATACGGGGATTAAAGCTACTAAACGGTCGTAGATGTGAATTTAG
GAATGTTCCCAAGACCGGCCTGGTTTTCAGGAGCTCTCCTTAATTTCGCC
CAGAACCTGCTCTTCCCACAGCTACGCGACAACGGCGGCGACGCGGTCGA
CGAGAACGCCATCGCGGTCATTGCCGCAACAGAGGGGACAGAACGGGAAC
ATGTCACTTGGAAAGAGCTCCGCGAACGTGTGCGTGTTTGTGCGGCGGCT
CTGAAACGGAGGGTTAAGAAGGGTGATATAGTGGCAGGGTACGTCGCGAA
TCAT

Sequences in the Contig:

SY0AAD62YO21FM1