Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YM17FM1
Length(NT) : 640
Best Gene Model Blast : Link to GSTUMT00002338001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_05351
Accession: ref|XP_001593923.1| Score: 518 E_value: 4e-51
KEGG Definition: hypothetical protein
Accession: ang:An04g05620 Score: 507 E_value: 4e-50
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1175 Score: 377 E_value: 3e-37
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 123 E_value: 9e-08
Swissprot: P16929|ACSA_NEUCR

Sequence:
>SY0AAD62YM17FM1
TTGGGTCTTACGGGTACAGTACTTAAACTTCCCCACCCCCTCCCTCTTTC
TTGAGAGTCTCATTCGCCTTTTCGATCTGTCAAATCTCCTTTCCCCCCAC
GATCACTTCGATCCGTAGCCAAAATTGGTGCACTGAGTCCAATGTTTTCG
GAGGTTCTCAAATCAAATTCTACGGAAATGTCCGAAGCAGAGGTTTCCGT
GGTGAGTGAGGCGCATAATGTTGAGACCTACCAAGTTCCCCGCAAGAAGC
ACCCAGCCAAACCTCATTTGACGTTGGAGGAGTACAAGGCTCAGTATCGT
GAATCCATCGAGAACCCGGATAAATTTTGGGGGGAGAAAGCGAGAGAACT
TCTTCACTGGGATATTCCATTTCAGACCGTAAGAAATGGATCCTTTCAGC
ATGGGGACATCAGCTGGTTCCTTGAGGGCCGTTTGAACGCTTGCTACAAT
TGTGTCGACAGACATGCTTTCAAGGATCCCGAGAGACCCGCGATTATCTA
CGAAGCCGACGAGCCGTCCGAAGGCCGCGTGATCACATACAGTGAGCTCC
TTCGTGAGGTATGCAAGTTGGCCTTTGTCCTAAGGCAGATGGGTGTCAGG
AAGGGAGATACCGTCGCCATTTACATGCCCATGATCCCGG

Sequences in the Contig:

SY0AAD62YM17FM1