Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YL15FM1
Length(NT) : 621
Best Gene Model Blast : Link to GSTUMT00009455001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03681
Accession: ref|XP_001244240.1| Score: 209 E_value: 3e-15
KEGG Definition: glutamyl-tRNA(Gln) amidotransferase, B subunit [EC:6.3.5.-]; K02434 aspartyl-tRNA(Asn)/glutamyl-tRNA (Gln) amidotransferase subunit B
Accession: afm:AFUA_3G11440 Score: 195 E_value: 6e-14
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG2438 Score: 221 E_value: 4e-19
PFAM Definition: GatB_Yqey, GatB domain. This domain is found in GatB. It is about 140 amino acid residues long. This domain is found at the C terminus of GatB, which transamidates Glu-tRNA to Gln-tRNA..
Pfam Number: pfam02637 Score: 118 E_value: 3e-07
Swissprot: Q33446|GATB_EMENI

Sequence:
>SY0AAD62YL15FM1
TTGGCCTGACCCAGACCTGGGTCCTGTGGTTATTGCGCCGGGGGTTGTAG
AGAGTGTGAGGAAGGAGTTGCCACTGCTGCCTGATGAAGTCCTCGAACAG
CTCACGGGAACGGGATATCACTTAAACGTGAGGGATGCACAAACGTTAAT
GATGTGGGACGAAGGAGAAGTAGGGGTAATATCCTACTACAAAGACGTCG
TCGAAAAGGTCACCACCGCGTTAGGAACCGCCGAAACAGCAAAACAAAAG
AAAGGCAAAGAAGTCGGAAAAATAGTTGGAAACTGGCTAATCCACGGACT
CGGCGGAACGCTAACAACCCATGCCCTCCCCTGGCCCCTTAACCCCCTCA
CACCAACCACTCTCTCATCACTAATCACCCACCTCCTAACCAACAAGATC
ACCTCCGCTACTGCGAAATCCCTCCTGTCAACAACCCTATTCTCTCCCAG
CGAAACCAGAACCGTGGAGCAGATAATCGAGCAGGAGAATCTCGCGATAA
AAGCCTTGTCGGAAGCGGAGCTGGAGGAGATTGTGCGCCGGACCGTGACG
AGCGATGATGACGATGGGCGGAGCGTTGGTGTTCTGGTGCAGCTTCGTGG
GCTACAAGAGGATGGGGGGGG

Sequences in the Contig:

SY0AAD62YL15FM1