Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YH24FM1
Length(NT) : 544
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001212453.1| Score: 394 E_value: 7e-37
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 390 E_value: 1e-36
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis].
Kog Number: KOG4177 Score: 235 E_value: 6e-21
PFAM Definition: No Hit Found
Swissprot: Q8UVC3|INVS_CHICK

Sequence:
>SY0AAD62YH24FM1
TTGGAAGAAACCGAAAATGTCACAATCCCCCAGTAATAATATCAACTCTT
CCAACGGGTCGTACAAAACACCACTCTGGTATGCTGCTAATAATGGGCAC
GAGGAAGTGGTGAAAATGCTGCTAGGGCGGCGGGATATCAGCCCCGAGAA
ACCAGATCGCAGCGGCCACACACCACTCTGGTATGCTGCTCACAATGGGC
ACGAGGGGGTGGTGGATGCGCTACTCGGACGGGACGAAGTCAAGCCCGGT
AGATCGGACCGGTTAGGCCTAACTCCACTTCATCTTGCTGCTATGAGAGG
GTGCGAGGGAGTGGTGAAAATACTACTCGGACGGGACGACGTCAACCCCG
ACGAACCAGATAACCACGGCCAAACACCCCTCATCTGCGCTGCTCAGGGT
GGGCACGAAGGGGTGGTGCAAACACTACTCGAACGGGACGACGTTAACCC
CGACAAGCCAGGTAACGACGGCCGGACACCGCTCCATTGCGCTGCTTCCA
GTGGGCACGAGGGAGTGGTGAAGATTCTACTCGGGCGGGACGAC

Sequences in the Contig:

SY0AAD62YH24FM1