Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YH01FM1
Length(NT) : 484
Best Gene Model Blast : Link to GSTUMT00009947001 E-value : 3e-88
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_14895
Accession: ref|XP_001805065.1| Score: 280 E_value: 1e-29
KEGG Definition: hypothetical protein
Accession: ang:An07g05210 Score: 284 E_value: 1e-29
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1176 Score: 175 E_value: 5e-14
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 198 E_value: 1e-16
Swissprot: Q8VCW8|ACSF2_MOUSE

Sequence:
>SY0AAD62YH01FM1
TTGGACCCCCTCTTCCTGCTAACATTCACGGATAGAGCAAAAGTGGTCTC
CGCCACCGACCGCACCGAAATCCTCCCTATAGGCCAACGCGGCGAACTGG
CAGTATCGGGATACCTCTTACAAAAGGGCTACTGGAATGACCCAATCCGC
ACAGCAGAAGTCATGGCTAAAGACGGGAACGGGAAGTTTTGGATGCATGT
AAGTGATTTTCCGCGCCACCTCTAATGTTTGTTCTCTTCTGTCATGGGTT
AATGAATCGGACGGACCGGGTAGACCGGAGACGAAGCAGAAATGGACGAG
AACGGGTATATCAAGATCACCGGAAGATTAAAAGATTTGATTATTCGGGG
GGGGGAGAACATTGCAGGTCCCCGAGAATCTCAGACTAGTGTTGGTATTG
GACTAATCCTCAAAGCACCCTCTCGAGATCGAAAATTGCCTGCTCAGCCA
TCCAAAGGTTCTCGAGTCTTCGGTTGTAGGGCTT

Sequences in the Contig:

SY0AAD62YH01FM1