Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YG04FM1
Length(NT) : 521
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: S-adenosylmethionine synthetase
Accession: ref|XP_001556886.1| Score: 650 E_value: 1e-66
KEGG Definition: S-ADENOSYLMETHIONINE SYNTHETASE (METHIONINE ADENOSYLTRANSFERASE) (ADOMET SYNTHETASE)
Accession: ncr:NCU02657.1 Score: 638 E_value: 2e-65
KOG Definition:
Classification: [Coenzyme transport and metabolism].
Kog Number: KOG1506 Score: 612 E_value: 1e-64
PFAM Definition: S-AdoMet_synt_N, S-adenosylmethionine synthetase, N-terminal domain. The three domains of S-adenosylmethionine synthetase have the same alpha+beta fold..
Pfam Number: pfam00438 Score: 496 E_value: 4e-51
Swissprot: P48466|METK_NEUCR

Sequence:
>SY0AAD62YG04FM1
TTGGCCTTCCACGTCTTCTCCCCCACAATCGCCTTCTCTTCCTCCCCCGA
GTCCTCATCTATATTTCCCTCCTCCTCAACCCCCAATCCGCAATCATGGT
CGCTGCTGTCAACGGCAACGGTGTCAAGTCCCACCACAACCAGGGCACTT
TCCTCTTCACCTCCGAGTCTGTTGGAGAAGGTCACCCAGATAAGATCGCC
GATCAGGTCTCCGATGCCATCCTCGATGCCTGCCTTCGTGAGGATCCCCT
CTCCAAGGTCGCTTGCGAGACCGCAACCAAGACCGGTATGATCATGGTCT
TCGGTGAGATCACCACCAAGACCCGTCTCGACTACCAGAAGACCATCCGT
GACGCCATCAAGGACATTGGTTACGACGACTCGGCCAAGGGCTTCGACTA
CAAGACTTGCAACGTGTTGGTTGCCATTGAGGAGCAATCCCCAGATATCG
CTCAAGGTCTCCACTTGGATGACGCTCTTGAGAAGTTGGGTGCCGGTGAT
CAAGGTATCATGTTCGGATAT

Sequences in the Contig:

SY0AAD62YG04FM1