Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YF01FM1
Length(NT) : 495
Best Gene Model Blast : Link to GSTUMT00002408001 E-value : 1e-169
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_10621
Accession: ref|XP_001588175.1| Score: 487 E_value: 9e-48
KEGG Definition: hypothetical protein [EC:2.7.7.6]; K03018 DNA-directed RNA polymerase III subunit C1
Accession: ani:AN2512.2 Score: 480 E_value: 3e-47
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG0462 Score: 439 E_value: 1e-44
PFAM Definition: No Hit Found
Swissprot: P46943|GUF1_YEAST
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion
GO:0003924 = Molecular function: GTPase activity

Sequence:
>SY0AAD62YF01FM1
TTGGCTCCTTACGTGCAGGTCAGGTCGGATACGTTTACTTCAACCCAGGG
ATGAAGAAGAGCTCCGAAGCAAAGGTCGGGGACACATTTACGCATGTCGG
TATGGGGAACGTTGTCCAGCCGTACCCAGGATTTGAGGAACCGAAACCTA
TGGTTTTCGTCGGAGCCTTTCCTGTGGATCAGTCGGAGTTTAATCAACTG
GACGATAGTATCAATCAGCTAGTTATTAACGATAGAAGTGTTACGCTCCA
TAAAGAGTCTTCGGAAGCTCTTGGGCAGGGGTGGAGGTTGGGTTTTCTGG
GTTTGCGTCATTTACTATCACTCGGATTTTTGGTGCTAACTTGATGAACC
GAAGGTACGTTGCATTGCTCGGTATTCGAAGACCGCCTGAGGCAGGAGCA
TGATACCTCAATCATCATTACCGCTCCAACGGTGCCATACATGATCAAAT
ACAAGAATGGCTCTGAAGTCATCGTCCGAAATCCGCACGAATTTC

Sequences in the Contig:

SY0AAD62YF01FM1