Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YD14FM1
Length(NT) : 550
Best Gene Model Blast : Link to GSTUMT00003340001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SNOG_11194
Accession: ref|XP_001801438.1| Score: 620 E_value: 5e-63
KEGG Definition: alpha glucosidase II, alpha subunit, putative [EC:3.2.1.84]; K05546 alpha 1,3-glucosidase
Accession: afm:AFUA_5G03500 Score: 599 E_value: 6e-61
KOG Definition:
Classification: [Carbohydrate transport and metabolism, Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG1066 Score: 689 E_value: 1e-73
PFAM Definition: Glyco_hydro_31, Glycosyl hydrolases family 31. Glycosyl hydrolases are key enzymes of carbohydrate metabolism. Family 31 comprises of enzymes that are, or similar to, alpha- galactosidases..
Pfam Number: pfam01055 Score: 295 E_value: 7e-28
Swissprot: Q14697|GANAB_HUMAN
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>SY0AAD62YD14FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCAACTACAATGAACCGTAC
CGCCTATATAACTCCGATGTCTTTGAATATGAAACCGACTCCCCAATGAC
TCTTTATGGCTCCATCCCTTTCATGCAGGCACAAAAGAAGGGCTCTACTG
TTGGAGTTTTTTGGCTTTCCGCTGCCGAAACATGGGTGGATGTCATTAAA
ACCAAACAAAACCCCCATGCTCTGACAACCGAGAAAGCGTCTACACAAAC
TCATTGGATTTCTGAAAGTGGTCTCCTAGACGTCTTTGTGCTCCTCGGTC
CCGATGCGGCCTGGGTTTATAGGCAGTACGGTGAACTCACTGGTTTTACC
ACTTTGCCTGCAATGTTCTCCATTGCTTATCACCAATGCCGCTGGAATTA
CGTCTCCCAAGATGATGTCAAGGATGTTGATAGGAAGTTCGATAAGTTTG
ACATTCCCTATGACGTTATCTGGCTAGATATTGAGCATACAGATGGCAAG
AGATATTTTACTTGGGATCCGTTGACATTCAGTAAGCCGGAGTCTATGCA

Sequences in the Contig:

SY0AAD62YD14FM1