Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YD12FM1
Length(NT) : 512
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein DEHA0E24332g
Accession: ref|XP_460298.1| Score: 267 E_value: 3e-22
KEGG Definition: hypothetical protein
Accession: dha:DEHA0E24332g Score: 267 E_value: 2e-22
KOG Definition:
Classification: [Translation, ribosomal structure and biogenesis].
Kog Number: KOG1722 Score: 286 E_value: 6e-27
PFAM Definition: Ribosomal_L24e, Ribosomal protein L24e..
Pfam Number: pfam01246 Score: 215 E_value: 1e-18
Swissprot: Q6BNC2|RL24_DEBHA

Sequence:
>SY0AAD62YD12FM1
TTGGGAAGGTTGAACTTGACTCCTTTTCCGGTGCTAAAATCTACCCAGGT
AGAGGTACTTTATTCGTCAGAGGTGACTCTAAGATTTTCAGATTCCAATC
ATCAAAATCTGCTTCTTTATTCCACCAAAGAAAGAACCCAAGAAGAATTT
CTTGGGACTGTTCTTTACAGAAGACAACACAAGAAGGGTTTAGCTGAAGA
ATCTTCAAAGAGAAGAACCAGAAAGACCGTCAAGAACCAAAGAGCTATTG
TCGGTGCTTCTTTAGAATTAATTAAGGAAAGAAGAAACCAAAAGCCAGCT
GAAAGAAAGAAGGCTAGAGATGATAAGTTAGCTGCTGACAAGGAATCTAA
GAAGGCTGCTAAGGTTGCTAGAAAGACCGAAAAGGCAAAGTCTGCTGCTT
CAGGTGTTTCTTCATCAAAGTTTTCTAAGCAACAATCTAAGGGTGCTTTC
CAAAAGGTTCACGCTACTTCCCGTTAAATAGTTTAACAATAGTTTCTCTT
TAATGTATGTTT

Sequences in the Contig:

SY0AAD62YD12FM1