Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD62YD04FM1
Length(NT) : 686
Best Gene Model Blast : Link to GSTUMT00008285001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: histidinol-phosphate aminotransferase
Accession: ref|XP_001210697.1| Score: 491 E_value: 6e-69
KEGG Definition: histidinol-phosphate aminotransferase [EC:2.6.1.9]; K00817 histidinol-phosphate aminotransferase
Accession: afm:AFUA_1G14090 Score: 495 E_value: 3e-68
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0633 Score: 383 E_value: 7e-38
PFAM Definition: Aminotran_1_2, Aminotransferase class I and II..
Pfam Number: pfam00155 Score: 202 E_value: 6e-17
Swissprot: P36605|HIS8_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004400 = Molecular function: histidinol-phosphate transaminase activity
GO:0000105 = Biological process: histidine biosynthetic process
GO:0010045 = Biological process: response to nickel ion

Sequence:
>SY0AAD62YD04FM1
TTGGCAAACACCGCCACCCTTTCATCTCTGTTAAACAACTTTGCCCGGAG
GATATCGTCATGGCGCCCACCAGTGCTTTCAACCTCCAGACTTGCGCACG
CAAGAATATTCTCCAATTGGTCCCATACCGATGCGCTCGAGATGACTACA
AAGACGACGGCAGCAACATCCTCTTGGACGCAAACGAGAACGCCTACGGT
CCTAGCCTACCCTTCAACTGTCCTGACGAGTCAGAGGCGGGAATAGGTTA
CGACTACACCCATCTAAATAGATACCCCGATCCACCTCAAAAGGCTCTTC
TGCAACTACCGTAATAAAAACCCTACTAAGCCGCTGACCCCGGCGAACTT
GTTCCTTGGCGTCGGCTCAGACGAGGCTATCGACGCGGTCCTCCGGTGCT
TCTGTATTCCTGGCAGGGACAAAATCCTAACATGCCCGCCAACTTACGGA
ATGTACAGCGTTAGTGCGCAGGTCAATGATGTCGAAGTTATAAGGGAGCC
ATTGGACCTGGTCAGCGGCGAGTTCGAGCTTCGTCCGGATGCGATCAACA
AACGTCTTTCGGAGGATCCCACTATTAAACTCGTCTACATATGCTCCCCC
GGAAACCCTACTGCAGGGACTGTCGATCCGGAAGCGGTACGTAAGGTCCT
CGCGCACCCGACATGGAACGGCGTTATCGTCGTCGA

Sequences in the Contig:

SY0AAD62YD04FM1