Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YP24FM1
Length(NT) : 330
Best Gene Model Blast : Link to GSTUMT00006605001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 204 E_value: 7e-23
KEGG Definition: hypothetical protein
Accession: ang:An02g10560 Score: 175 E_value: 3e-19
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0509 Score: 141 E_value: 2e-10
PFAM Definition: No Hit Found
Swissprot: Q6DGX3|ANR54_DANRE

Sequence:
>SY0AAD61YP24FM1
TTGGGCTGAGTTGGGGAATGAAAGTGTAGTAGAGCTGCTTCTAGAGTGGG
GGGATGTCGATCCGGACTCGATAGATGAGGGTGGGCGAACACCACTATCA
TATGCCGCGGGGTCTATACATGAAGTAGTAGTCCAGCTACTTCTTGAGCG
TGGGGACGTCAACCCCGATTCACCAGATAATGGTGGACGAACACCACTAT
CCTATGCCGCGGAGCCCGGAGCGAAGGTGTAGTCAAGCTACTTCTTGAGC
GCGGGGATGTCAATCCAGATTCACCAGATAATGGTGGACGAACACCACTA
TCTTATGCCGCGGAGCCCGGGAGCGAAGGT

Sequences in the Contig:

SY0AAD61YP24FM1