Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YO21FM1
Length(NT) : 286
Best Gene Model Blast : Link to GSTUMT00005527001 E-value : 1e-158
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein BC1G_10580
Accession: ref|XP_001550856.1| Score: 249 E_value: 3e-20
KEGG Definition: hypothetical protein [EC:3.1.2.15]; K01072 ubiquitin thiolesterase
Accession: ani:AN7422.2 Score: 248 E_value: 2e-20
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0944 Score: 243 E_value: 3e-22
PFAM Definition: UBA, UBA/TS-N domain. This small domain is composed of three alpha helices. This family includes the previously defined UBA and TS-N domains. The UBA-domain (ubiquitin associated domain) is a novel sequence motif found in several proteins having connections to ubiquitin and the ubiquitination pathway. The structure of the UBA domain consists of a compact three helix bundle. This domain is found at the N terminus of EF-TS hence the name TS-N. The structure of EF-TS is known and this domain is implicated in its interaction with EF-TU. The domain has been found in non EF-TS proteins such as alpha-NAC and MJ0280..
Pfam Number: pfam00627 Score: 107 E_value: 2e-06
Swissprot: Q11119|UBP14_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0031593 = Molecular function: polyubiquitin binding
GO:0043161 = Biological process: proteasomal ubiquitin-dependent protein catabolic process

Sequence:
>SY0AAD61YO21FM1
TTGGAGCTTCTCCCCGAGGACGAAGAGCCTGGGTTCCAAGCAGATGAAGG
TATTGTAGGCCAACTTGAGGCAATGGGCTTTCCAAGAATGCGTGCCGAAA
AGGCTCTGTATCATACTGGCAACAAGGATTCAGAGGCAGCAATGAATTGG
CTCTTTGCCCATATGGATGATCCGGATATCGACGCCCAAATGTCTTTTGC
ACCGAAAAAGGACTCATCGGGTACTGAGCCTGATGAGGAGAAGGTATCAA
TGTTGGGAGCTATGGGATTCACCGCTAGCCAAGCTA

Sequences in the Contig:

SY0AAD61YO21FM1