Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YN24FM1
Length(NT) : 454
Best Gene Model Blast : Link to GSTUMT00011984001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein AN3851.2
Accession: ref|XP_661455.1| Score: 143 E_value: 6e-08
KEGG Definition: hypothetical protein
Accession: ani:AN3851.2 Score: 143 E_value: 3e-08
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD61YN24FM1
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGTTTGAACCATATCAAA
GGTGACTGTTTACCCACTGCCGAGCTCCAGAACTTCAAGATCCTCGGGTA
GCCCGAGAATTTTGTCAAGGGCATCTAGCCTTTTGCCTTCATTATCAACC
TTAGAGGTGGGAATGTTCTGTGCAAGATATGCTGCCAATGATGGTTACTT
TACATACCAGATATGCCTGGCAATGCTCTCCCCGGTTTCTTCCCACACCG
GTAAAGCCATTTTCCGGCCAATTGTCAATCTCCGTTCGACATACCCTTCG
GCCTCGATGCCGCCTAAAGGTCTAAATGGAGAGCTATATGCTGAGAGAAC
TAATGAGCCGGCAGCTTCTAATTGCGAAAGATCGTCGGCGGCAGATTGCT
CGCTAGAGACGGAGAGTACAACAGCACGGTGGAATATTTCCTTTTGCTTG
ATGA

Sequences in the Contig:

SY0AAD61YN24FM1