Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YK03FM1
Length(NT) : 595
Best Gene Model Blast : Link to GSTUMT00004128001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: Ankyrin repeat protein
Accession: gb|EDP48589.1| Score: 269 E_value: 4e-38
KEGG Definition: ankyrin repeat
Accession: aor:AO090010000141 Score: 277 E_value: 1e-34
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0507 Score: 165 E_value: 1e-12
PFAM Definition: No Hit Found
Swissprot: Q8UVC3|INVS_CHICK

Sequence:
>SY0AAD61YK03FM1
TTGGGGATTGTTGAACTTATGACCGCACTGATAAATGATAAGGGTTGCGA
CATCAATCAGCGAGATAGCATAGATCGCACACCACTCGCTTGGGCCGCGG
GAATGGGACATGAAGAGATGGTAATGATATTGCTGGAGCGAGAAGATGTT
GACCCCAGTCTTCCGGATAACTATGATCGGACGCCGCTCGGATGGGTTGC
TCTTGATGGACATGAAGAAGTTGTTAAGTTACTTTTGGGGCGGGGGATGT
CGACCCCAATAATGCAGATAATATTGGTCGGACACCACTCGGGATTGCTG
CTTTCGAGGGACATGAAGGATTGGTAAGACTACTCCTGGGGCACGAAGAA
GTTGACGCGGACAAGCGTGATAACCAAGACTCTACACCACTCTCATTGGC
CGCTTATAATGGACATGGAGGAGTCGCGAAGCTACTACTTGACCGGAACG
GTGTTGACCCAAATCGCCCCGACGAGCACGATCGAACACCACTCTGGTGG
GCTGCTCTTCATGGACACGAAGGAGTTGTCAAGCTACTCTTGGGCCGGGA
GGATGTCGACCCTAATCGTGCTGATGATGGCCGGATACCACTCGG

Sequences in the Contig:

SY0AAD61YK03FM1