Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YF24FM1
Length(NT) : 479
Best Gene Model Blast : Link to GSTUMT00011627001 E-value : 5e-28
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_03770
Accession: ref|XP_001244329.1| Score: 186 E_value: 4e-21
KEGG Definition: hypothetical protein [EC:3.6.1.-]; K01529
Accession: ani:AN4903.2 Score: 187 E_value: 2e-20
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG0340 Score: 174 E_value: 6e-14
PFAM Definition: DEAD, DEAD/DEAH box helicase. Members of this family include the DEAD and DEAH box helicases. Helicases are involved in unwinding nucleic acids. The DEAD box helicases are involved in various aspects of RNA metabolism, including nuclear transcription, pre mRNA splicing, ribosome biogenesis, nucleocytoplasmic transport, translation, RNA decay and organellar gene expression..
Pfam Number: pfam00270 Score: 114 E_value: 5e-07
Swissprot: Q1E0Z3|DBP8_COCIM

Sequence:
>SY0AAD61YF24FM1
TTGGGGGTTAAAATGAGCGCGAAAACACCAAATGGATCCTCAGCCCACAT
CTGTAATATGGGAGCCGCGAATGCAACAGTCTTTCCTGAACCAGTTTGTG
ACCCCCCGATGCAATCCTTCCCTACATTCGTGTTAGCGGTGCGTTCTGGG
TGAAGGGGAAATGAAGTGAGCAAATGCCTTCAAGAATAGGTCCAATACAA
GCAGCCTGGATCGGTGTCGGCTTTCGTATCGCCATTGCGCCTAATGAATC
GGCAAGCCATCTTTCAATTCCAAGATCTGTGAAATTCGTTGGTTCTGGCA
TTTTCGGCATTGAAAGAGTCGAAAGAGATTCCGGAGGCAGAAAACAAAAA
TGCGGCTCTGTCGTACAACACAGGATTAAAGTTAAGAGAAGCATGAAGCA
TCTTGGCATTTAGTTACCCTAACCCCAGCTATACTCGGAGATCTATCATA
ATATATGATAGATCATGGACTATAATACG

Sequences in the Contig:

SY0AAD61YF24FM1