Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YE01FM1
Length(NT) : 591
Best Gene Model Blast : Link to GSTUMT00004638001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001261702.1| Score: 190 E_value: 4e-13
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_8G00790 Score: 173 E_value: 2e-11
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD61YE01FM1
TTGGCTAAAGATGGATCGATTCTTCCTTCGCCATGACTATGCCGAAGACC
AGCCCTACTCGCGCACTATCCTCACCACACATGTCTTACATCGTGGGGCC
AACCTCGGGGCGGTTTTCGGAGCTCTCTATGGCGGGGCTCGATACGGGCT
CTCCACCCACGCCCGCAGTTTACCACTAGTAGCCTCTATTGTCCGGGCTT
CGGGTGTTGGAGTTGTTGTAACCACTGGCATTACCGCGGTAATGCTTTCG
GCGAGGATGTACGGGAAGCAGGAGATCGAGTGGCAAGACAGATCATGGAG
GCTGCTCGAGAATAAGCCTCAGAACAGGATCGATGAATGGAGTGCCTCGG
GAGCACTTGTAGGTGGGGTGTTGGGGGGTGTGAAGAAGGGCCTAGGCTGG
AGGGGTATTACCGGGAGTGCGGGAATCGGAAGTGTCGTTGGAATTGTTGG
CTGGGCGGTTTACAATAAAACGCGGGGGCCGGGAGAGCAAGTAAAAGTGG
CGAAAAATTTGGAGAAGACCATTGTCAAATCATAAATTCTTTCTTGCTTG
GATTTTCCTACTTTTCATAATCCGGCCTATTAACTTTACCC

Sequences in the Contig:

SY0AAD61YE01FM1