Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD61YC23FM1
Length(NT) : 637
Best Gene Model Blast : Link to GSTUMT00007681001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: predicted protein
Accession: ref|XP_001541354.1| Score: 183 E_value: 3e-12
KEGG Definition: hypothetical protein
Accession: ang:An08g04420 Score: 173 E_value: 2e-11
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG4676 Score: 178 E_value: 4e-14
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 158 E_value: 8e-12

Sequence:
>SY0AAD61YC23FM1
TTGGCTCCACCCTTCCACCACCGCACCCATCCCTACCTCCCGCACCAATC
CTCTCCGAGGAAGCGAAATCCACAATTGATCTTCTCAAAACAACCTACAA
AAAGCGCGGTCATTTCGACTCTTTGCGAAAAGATATCTACCAATCTTTTA
CCGATAGCGACACAAAGCTCCACTTCCTAACCGCCCTCGAGAAAATCGCT
AGTGCAGAGATCGAGCGCGACCCAAGTTTGCTTGCGAGGGATAAGAAGAA
AGCGGCGGAATTGATCGAAGCTACGGTTTTACGGGGGGATACGTATTCTA
ATGTAGAGAAGGCAGTGGAAGAACTACTTGCCGCCCGGAGGGCCGAGATT
GAAGGGATGCTGAGGGGGATCATGGAGGAGCAGGGGCTTTTGCCGAGGGA
TGAAGAAGAGGAGAGAAGTGAGAAGGAGGGGAAGGATAGGGATGGGGATG
CGGATATGGGTGATGCTGTGGCTGTGCCTGTTGAGAGGGAGCGCGAGAGG
GATGGCGATAGGGACAGGGAGAGGGGTCGTGAGAGAGACAGGGAGAGGGA
GAAGGAGAGGGAGCGGGACCGTGATAGGGAAAGGGAAAGGGAAAGGGAGA
GAGACCGCGAGCGAGAAAGGGAACGGGATCGCGACAG

Sequences in the Contig:

SY0AAD61YC23FM1