Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YP15FM1
Length(NT) : 531
Best Gene Model Blast : Link to GSTUMT00011954001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein SS1G_12900
Accession: ref|XP_001586322.1| Score: 473 E_value: 5e-46
KEGG Definition: hypothetical protein [EC:2.7.1.67]; K00888 phosphatidylinositol 4-kinase
Accession: mgr:MGG_13790 Score: 457 E_value: 2e-44
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG0902 Score: 144 E_value: 2e-10
PFAM Definition: No Hit Found
Swissprot: Q9USR3|STT4_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>SY0AAD60YP15FM1
TTGGCTCACTTTGCTATGGCTGAGCTGTTTGGAGGAGGAGACCGATGAGT
ATACCACTCGTTCCATCTTTACTTCGGTGAAGGGGGGAGTTTCGGTTGAA
CTGCCAGATTCTTACTTATTCCGACGCAAGCTACTGAAAGTATTTCAGGC
CAAGGCAAAAGCGTGGGTTCTTCAAGTCTTGAATGTGGCCCCACTTGATG
TCAAAGGCCTTATGCAAACTTACCTTTCCGAATTCGAAGATGAAGGCAGT
CTCGGGCATGTATCCCTTGGTCGATCTTTTGCCGTGGAAATTGGATCTGC
GGTCCCGAGCGGTGACCAGAGGCTAGCATCAATCGATCACCGTCGGGATT
GCGATGGCAACGTTGCCTCTGATTTTGTCATGCAATACACAACTCGTCAA
GCGTACCGTTACACCGAGCCAGCTCTTGAGTATCACCAAGATTGGCTAAG
CATACGACCTCTTGGGGACTCTGCTAACTCCTCTAATGCCCCGTCCATAA
TGCGTCCGGATTCTGCACAAGCCCTTTTGTC

Sequences in the Contig:

SY0AAD60YP15FM1