Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YP05FM1
Length(NT) : 627
Best Gene Model Blast : Link to GSTUMT00010629001 E-value : 1e-139
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein PICST_86741
Accession: ref|XP_001387004.1| Score: 204 E_value: 2e-32
KEGG Definition: predicted protein
Accession: pic:PICST_86741 Score: 204 E_value: 8e-33
KOG Definition:
Classification: [Nuclear structure, Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2020 Score: 177 E_value: 5e-14
PFAM Definition: Xpo1, Exportin 1-like protein. The sequences featured in this family are similar to a region close to the N-terminus of yeast exportin 1 (Xpo1, Crm1). This region is found just C-terminal to an importin-beta N-terminal domain (pfam03810) in many members of this family. Exportin 1 is a nuclear export receptor that interacts with leucine-rich nuclear export signal (NES) sequences, and Ran-GTP, and is involved in translocation of proteins out of the nucleus..
Pfam Number: pfam08389 Score: 145 E_value: 2e-10
Swissprot: Q9TVM2|XPO1_DROME
Gene Ontology:
GO:0005643 = Cellular component: nuclear pore
GO:0005515 = Molecular function: protein binding
GO:0008565 = Molecular function: protein transporter activity
GO:0007275 = Biological process: multicellular organismal development
GO:0015031 = Biological process: protein transport

Sequence:
>SY0AAD60YP05FM1
TTGGCAACCGTAGCCTGCAAACCATCAAATCCTTACTTGACCACTGCTAC
GTCTGATATACTTCAGAACACCGCCACTTCTCGAGAGCTTACCTGGGGAA
GCTTTGCACCACCGTCCAGCACTTTACAATGGCCGCTTTGACAATAGATG
AGCTGGATCTACATGTTCGCATGTTTTATGAAGGAACAGGCGCAGATAGA
AAAAATGCACAACTTGTTCTCAATCAGTTCAGCGAGAGTCCAGACTCATG
GACTATGGTGGATAAGATGTTGGAATCGGCAAATTACCCTGAGACAAAAT
TCCTTGGGCTACGGGTACTAGACCAGGTCATCCAGACGCGATGGAAAGTG
TTGCCAAAAGAGCAGAGACAGGGTATGGACCACCTGAACAAAGGATTTGT
CCTCCCAAAATCAAGACTCATAGCAAGCCTTAGGTATCCGGAATTTTGTC
GTCGGGTTTATCATCCAAGAGTCGTCCACTCCCGAGAATCTACACCAGAA
GAGAATATTGATCAACAAATTGAATCTGGTTCTGGTGTCAATACTGAAGC
AGGATTGGCCTCATGACTGGCCCGATTTTATTAATGAGATTATTAGCTCG
TGTCGGAGCAACCTCTCTATCTGCGAA

Sequences in the Contig:

SY0AAD60YP05FM1