Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YP04FM1
Length(NT) : 606
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE57037.1| Score: 162 E_value: 7e-10
KEGG Definition: ankyrin repeat
Accession: aor:AO090001000528 Score: 162 E_value: 4e-10
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>SY0AAD60YP04FM1
TTGGCAGAAAATGTCTCCATTCCCCGACAATGCCCAACTCCCTTAGCACT
ACCCCTTCTCTTGACACTAACTCTCTCGATAATCACCTTTCGAACAGCAT
TACCGTCGTCGATGATCGGTCCGGGCTCCTGACCTGGTCGTCTCCTCTCG
AGCCCCACATACGGTATCAGGACGCTGAAGCACGCCGTCTTGACCATGTG
GGGGACTGGCTTCCACAGTCTGGGCAACTTGGAAGCTGGTGCGACGGTAA
TAGCCAAGGTGAATCTCGGGATGGGACAACATTTTGCTGCTGTGCTCCGG
TGGTCGACAAGACATATCTCAGTTCCCTGGTAATAGATACCCTATACGAC
CAGGCCGAAGGACGGAATATTGCCGTTGCATGTTTCTACTTTGACTTCGC
CACTGGAAAGGTCCGGACTCCGGCGAGTACGCTCGGTGCCCTGCTGAAAC
AGGTGGTGGATAGACTGGACAAGATTCCCGGAGAAATAATACCTGCTTTT
GGAAGGCAGAGAAAAGACATCGGTGGTCGGAGACTCCGACTCCCTCAAAT
TGTGAAGATGTTGGAGACTGTTATGTCCTCACAGCGTACATTTATATGCA
TCGATG

Sequences in the Contig:

SY0AAD60YP04FM1