Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YO21FM1
Length(NT) : 199
Best Gene Model Blast : Link to GSTUMT00003782001 E-value : 1e-07
Numbers of ESTs : 1

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG1923 Score: 106 E_value: 2e-06
PFAM Definition: FAP, Fibronectin-attachment protein (FAP). This family contains bacterial fibronectin-attachment proteins (FAP). Family members are rich in alanine and proline, are approximately 300 long, and seem to be restricted to mycobacteria. These proteins contain a fibronectin-binding motif that allows mycobacteria to bind to fibronectin in the extracellular matrix..
Pfam Number: pfam07174 Score: 108 E_value: 1e-06

Sequence:
>SY0AAD60YO21FM1
TTGGAGCAGGAGGAGAGTGAGACGGCAAGGGAGGTAGAGAAGGAGGAGGA
GACGATGGAGGTGCTAGGGGAGAGGGAGGGTGAGCGGCTTGCTATCAAGG
AAGAGCTTTAGGTGGGCCGGGATAAGGGGGCGGGGGATCTGTATTTGTAT
TTAATGGAGAGTACTTTTATCGTAGTGGTTACCGGAACAGTGAACTCGG

Sequences in the Contig:

SY0AAD60YO21FM1