Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YN10FM1
Length(NT) : 530
Best Gene Model Blast : Link to GSTUMT00007546001 E-value : 0.0
Numbers of ESTs : 1

Blast Results:

Nr Definition: hypothetical protein CIMG_02066
Accession: ref|XP_001248295.1| Score: 452 E_value: 1e-43
KEGG Definition: hypothetical protein
Accession: fgr:FG07024.1 Score: 452 E_value: 6e-44
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG0395 Score: 264 E_value: 3e-24
PFAM Definition: Ras, Ras family. Includes sub-families Ras, Rab, Rac, Ral, Ran, Rap Ypt1 and more. Shares P-loop motif with GTP_EFTU, arf and myosin_head. See pfam00009 pfam00025, pfam00063. As regards Rab GTPases, these are important regulators of vesicle formation, motility and fusion. They share a fold in common with all Ras GTPases: this is a six-stranded beta-sheet surrounded by five alpha-helices..
Pfam Number: pfam00071 Score: 283 E_value: 2e-26
Swissprot: Q9UQX7|RAS1_CANAL
Gene Ontology:
GO:0005886 = Cellular component: plasma membrane

Sequence:
>SY0AAD60YN10FM1
TTGGGGCTTGCTATTTTACTGGTTGCCCGTAATATCTGCCCGAGGGAAGA
TCTCTTTTTTTCTTCTTCCCCTTTCTGTCCAGATCTAGAATTTCTTTCGC
ACTCAATTGATCAAAAGAGGGAGGAGAAAGAAGAAGAAGAAGAGCGATGG
AAACGATATCCATCACTGTCTGCGGTGACGGCGGGACTGGTAAATCCTCC
ATCTCCCTCCGCCTGGTCCGCAGTAAATGGACGCACGAGTACGACCCGAC
GGTGCAAGATTCCTACAGCGTGACCCGCACCGTCGACGGCCGCGAGTACT
CCCTACACCTCACCGACACCGCCGGGCAGGAGGAGTACCGTGGCCTCTGG
GCCTCGCACAACCTCGCGGCCGACGCTTATCTGCTCGTTTACGACATCAC
CAATCACGATAGCTTGTTGGCGCTGGATTACTTCCACAACTTGGTCGAGA
TGGAGGAGGAGGGGCGGAGCGTTCCCGTCGTCAAGATCGTCGCGGGGAAT
AAGTGCGATCTGGCGGAGGGCAGGCAGGTC

Sequences in the Contig:

SY0AAD60YN10FM1