Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: SY0AAD60YM12FM1
Length(NT) : 587
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 1

Blast Results:

Nr Definition: D-lactate dehydrogenase, putative
Accession: ref|XP_001268570.1| Score: 594 E_value: 6e-60
KEGG Definition: D-hydroxyacid dehydrogenase [EC:1.1.1.28]; K03778 D-lactate dehydrogenase
Accession: cne:CNA08110 Score: 594 E_value: 3e-60
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0068 Score: 370 E_value: 2e-36
PFAM Definition: 2-Hacid_dh, D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain. This family represents the largest portion of the catalytic domain of 2-hydroxyacid dehydrogenases as the NAD binding domain is inserted within the structural domain..
Pfam Number: pfam00389 Score: 442 E_value: 7e-45
Swissprot: P44501|DDH_HAEIN

Sequence:
>SY0AAD60YM12FM1
TTGGCCGGCCGCCTCACCACATCCACGTCTCAAGATGAAGAACTTCAAGA
TATCCGTCTTCAGCGCCCAATCCTACGACCGCACCTACCTCACAGCCGCC
AACGCAAAGCCCGAATTCGCCAACTACAACTTCGAAATCGACTTCCACCC
CATCGCGCTCTCTGAATCGACGGTCCCCCTCGCCCAAGCCAGCGACGCCG
TCTGCATCTTCGTCAATGACGTTGCCGACTCGGCCGTGCTGAACGCCCTG
CACCAAAACGGCACGCGCGCCGTCCTCCTCCGTTGCGCAGGCTACAACAA
CGTCGACCTCGACGTCGCGGAGCAACTCGGCATTTTCGTCGCACACGTCC
CGGCCTACTCGCCTGAGGCCGTGGCTGAATATGCAGTCACGCTCATTCAG
ACGCTGAATCGTCAGACCCATCGCGCGTATAACCGTGTGCGCGAGGGAAA
CTTCCAATTGGCTGGCTTGATGGGCTTCACCATGAGTGGGAAGACCGTGG
GGTTGATTGGAACGGGGAGGATTGGCATTTTCACGGCCAGGATTTTGAAG
GGCTTTGGCTGCCATTTGTTGGCCTATGATCCTTATC

Sequences in the Contig:

SY0AAD60YM12FM1